Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.227663 |
Chromosome: | chromosome 11 |
Location: | 2834914 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g477625 | CHLH2,MCH2 | Magnesium chelatase subunit H; (1 of 1) PTHR23304//PTHR23304:SF109 - SPOT2-RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAAGTGAAAATGAATTTCGTCCACCCCAT |
Internal bar code: | GATATGGGACTCCCGTCGGAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 770 |
LEAP-Seq percent confirming: | 93.4482 |
LEAP-Seq n confirming: | 2767 |
LEAP-Seq n nonconfirming: | 194 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATGAGTGTAACCCCTCCCC |
Suggested primer 2: | ACCCGGTAACCATACCAACA |