| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.227735 |
| Chromosome: | chromosome 7 |
| Location: | 4101641 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g340750 | EXN11 | RNaseT, SDN2 homolog; (1 of 1) PTHR12801:SF69 - RNA EXONUCLEASE NEF-SP-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCAAATGCATCACTCCTCGCCTGCCTAC |
| Internal bar code: | GAGGCTGTCCGGAGTCCCCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 412 |
| LEAP-Seq percent confirming: | 98.2739 |
| LEAP-Seq n confirming: | 24709 |
| LEAP-Seq n nonconfirming: | 434 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATATGTGCATCCCACCCCT |
| Suggested primer 2: | CGGGCCAAGTACTATGCAAT |