Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.227876 |
Chromosome: | chromosome 7 |
Location: | 467184 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g315550 | (1 of 2) IPR005654//IPR027417 - ATPase, AFG1-like // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTAACCCCCCAACACACGCACGCACCCA |
Internal bar code: | CGGGTCATGTGTCTTGGGAAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 299 |
LEAP-Seq percent confirming: | 98.5161 |
LEAP-Seq n confirming: | 4780 |
LEAP-Seq n nonconfirming: | 72 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCAGCCTGCTGCTATCTCA |
Suggested primer 2: | ACAGCTCACTGCATGTACGG |