| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.228008 |
| Chromosome: | chromosome 3 |
| Location: | 6007502 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g190850 | ECH1 | EnoylCoA hydratase/isomerase; (1 of 1) K13238 - 3,2-trans-enoyl-CoA isomerase, mitochondrial (DCI) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTGGCTGGTGTGACGGGCGCGCTGGTC |
| Internal bar code: | GGGACACGTCACGGGAACATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 213 |
| LEAP-Seq percent confirming: | 35.9958 |
| LEAP-Seq n confirming: | 1023 |
| LEAP-Seq n nonconfirming: | 1819 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGTCCTTGTTGCTGGACA |
| Suggested primer 2: | TTTCTGAGTCACTTGCACCG |