| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.228078 |
| Chromosome: | chromosome 3 |
| Location: | 2067756 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g156600 | GluTRBP,GTRBP1 | (1 of 1) PTHR13343//PTHR13343:SF14 - CREG1 PROTEIN // GENOMIC DNA, CHROMOSOME 3, P1 CLONE: MXL8; Glutamyl-tRNA reductase binding protein 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACATCCAGTTTGTGATATTATCTTCTCT |
| Internal bar code: | ACCCATCGCTGGCCGCGCTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1122 |
| LEAP-Seq percent confirming: | 99.2436 |
| LEAP-Seq n confirming: | 5904 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAGGTAGACGCTTACGGC |
| Suggested primer 2: | GTGGGAAGTGCACCGACTAT |