| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.228094 |
| Chromosome: | chromosome 3 |
| Location: | 2445211 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g159350 | (1 of 1) IPR001680//IPR011044//IPR011047//IPR015943//IPR017986//IPR027417 - WD40 repeat // Quinoprotein amine dehydrogenase, beta chain-like // Quinonprotein alcohol dehydrogenase-like superfamily // WD40/YVTN repeat-like-containing domain // WD40-repeat-containing domain // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGCGACACAGCGCACTCCGCGGGCGGC |
| Internal bar code: | GGCTTTAGCAAGGTGGGCAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 664 |
| LEAP-Seq percent confirming: | 98.3361 |
| LEAP-Seq n confirming: | 12411 |
| LEAP-Seq n nonconfirming: | 210 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGGCTGAGACCTTAATCA |
| Suggested primer 2: | ATAGCACCACGCTGATACCC |