| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.228100 |
| Chromosome: | chromosome 7 |
| Location: | 505860 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g316050 | CDJ2 | Chloroplast DnaJ-like protein 2; (1 of 4) K03686 - molecular chaperone DnaJ (dnaJ) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGACACCAGCTCCGCCCCCCGACAGCAGT |
| Internal bar code: | TAGCCCGCCATATGACAGGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 607 |
| LEAP-Seq percent confirming: | 94.937 |
| LEAP-Seq n confirming: | 4294 |
| LEAP-Seq n nonconfirming: | 229 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAAAGTCCTAACGAGCCG |
| Suggested primer 2: | GATGGCTTTTGTTGACGGTT |