| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.228123 |
| Chromosome: | chromosome 12 |
| Location: | 3241512 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498550 | MPM1,CHLM1,CHLM | Mg protoporphyrin IX S-adenosyl methionine O-methyl transferase; (1 of 1) K03428 - magnesium-protoporphyrin O-methyltransferase (E2.1.1.11, chlM, bchM) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAACCGACCAAGCTGTCGCCTTTCCGCA |
| Internal bar code: | ACCGTCATGAGTTCCACGTATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 907 |
| LEAP-Seq percent confirming: | 98.1261 |
| LEAP-Seq n confirming: | 576 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACAACGTCAGCTCGTCAT |
| Suggested primer 2: | ATATGAAAGCGGAGGAGGGT |