| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.228162 |
| Chromosome: | chromosome 16 |
| Location: | 4663526 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687350 | ACO3,ACX3 | (1 of 1) PTHR10909:SF11 - ACYL-COENZYME A OXIDASE-LIKE PROTEIN; Acyl-CoA oxidase/dehydrogenase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTGAAATTTATAGCGTCGCCATTAGGAC |
| Internal bar code: | TCCGGCGTCCCGGAAGCGATCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 566 |
| LEAP-Seq percent confirming: | 98.0874 |
| LEAP-Seq n confirming: | 359 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGAAGCATCAAGATCGCC |
| Suggested primer 2: | ATGCGGTTGACACCCTACTC |