| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.228166 |
| Chromosome: | chromosome 6 |
| Location: | 8021252 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g304100 | (1 of 1) K17261 - adenylyl cyclase-associated protein (CAP1_2, SRV2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGATTATTTAAGAAGTGGACACGTAGCCG |
| Internal bar code: | CCGTGGCAGCCGCGTCCGGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 315 |
| LEAP-Seq percent confirming: | 98.8764 |
| LEAP-Seq n confirming: | 88 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATTTCCTTCTGCAGCCTC |
| Suggested primer 2: | GGGATGTGAGCAAGCTCTTC |