| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.228176 |
| Chromosome: | chromosome 2 |
| Location: | 2476150 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092000 | DEG2 | Deg protease; (1 of 5) 3.4.21.108 - HtrA2 peptidase / Serine proteinase OMI | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCAGTGCGAAGGCGGGAACGGACACCA |
| Internal bar code: | TGCCAAATGGTTTGCCTCGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 428 |
| LEAP-Seq percent confirming: | 96.0163 |
| LEAP-Seq n confirming: | 3302 |
| LEAP-Seq n nonconfirming: | 137 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACCTGGGGCATACATACT |
| Suggested primer 2: | CATAACAATCATACGCCCCC |