Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.228217 |
Chromosome: | chromosome 2 |
Location: | 5467973 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g107850 | MOB1 | (1 of 1) K06685 - MOB kinase activator 1 (MOB1, Mats); Cytokinesis-related protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAAAGACGAGGCGAGCGGCGTAGACCCAC |
Internal bar code: | CCGGCTATCTTCCCATAATTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1228 |
LEAP-Seq percent confirming: | 96.4686 |
LEAP-Seq n confirming: | 2322 |
LEAP-Seq n nonconfirming: | 85 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTCAACTGGGCAATAACGG |
Suggested primer 2: | CCTCATCGATGTTGCTCTGA |