| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.228249 |
| Chromosome: | chromosome 10 |
| Location: | 5473065 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g458900 | SRR33 | (1 of 39) IPR001190 - SRCR domain; Scavenger receptor cysteine rich (SRCR) protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTAAGTAGTAATGCTGGGCACGTAAGCCA |
| Internal bar code: | GGGAAGGGAGCTCACGACCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 634 |
| LEAP-Seq percent confirming: | 98.5267 |
| LEAP-Seq n confirming: | 1070 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCGAGTGTCGGATGACAG |
| Suggested primer 2: | TGCCCCTTCTGGACATTTAG |