Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.228290 |
Chromosome: | chromosome 7 |
Location: | 2254843 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g327500 | (1 of 3) PF10358 - N-terminal C2 in EEIG1 and EHBP1 proteins (NT-C2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGTCACGTAAGCAGCCCCTTCACTCCGC |
Internal bar code: | AGGAACTATGCCCGGGCTCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 644 |
LEAP-Seq percent confirming: | 99.3964 |
LEAP-Seq n confirming: | 988 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTCACACACACACACACA |
Suggested primer 2: | CAGCCAACTTGCACCAACTA |