Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.228350 |
Chromosome: | chromosome 12 |
Location: | 1899516 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g511100 | (1 of 1) IPR000104//IPR007379 - Antifreeze protein, type I // Tim44-like domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGCTGGTGGCGGGCGCGTCCGTCTTCG |
Internal bar code: | GGTATTGAGCACGGGATTGCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1086 |
LEAP-Seq percent confirming: | 99.1785 |
LEAP-Seq n confirming: | 28735 |
LEAP-Seq n nonconfirming: | 238 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTTGGTGATGATGGTGGT |
Suggested primer 2: | CGAACGATCCGTATTGGAGT |