Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.228369 |
Chromosome: | chromosome 10 |
Location: | 2522085 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g436500 | XPP | SurE-like phosphatase/nucleotidase; (1 of 1) PTHR30457:SF0 - 5'/3'-NUCLEOTIDASE SURE | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAAACAGTCGCGCTGCAACGAGAAACTGC |
Internal bar code: | TTCTTCCAAAGATAGTAACATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 628 |
LEAP-Seq percent confirming: | 99.2993 |
LEAP-Seq n confirming: | 992 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGGTTGATCGAAACTGGGG |
Suggested primer 2: | TCAGCGCAGCAAACATAATC |