| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.228418 |
| Chromosome: | chromosome 11 |
| Location: | 1039191 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467670 | GT90F44,GT90-44 | (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90); GT90 family protein 44 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGGGCCCATGATCCAGCTCGTCACCCTG |
| Internal bar code: | TGACTTGTCTGGTGGTTCGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 660 |
| LEAP-Seq percent confirming: | 99.7701 |
| LEAP-Seq n confirming: | 434 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTACGGCCGTCTCTCAACT |
| Suggested primer 2: | GTAGGAAAAGTCCATGCCGA |