| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.228546 |
| Chromosome: | chromosome 4 |
| Location: | 2174116 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g219787 | (1 of 1) 2.5.1.74 - 1,4-dihydroxy-2-naphthoate polyprenyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACACACCACGTCGCTTTGAGCCCTCCTG |
| Internal bar code: | GCGCCCGGGAGGGGAGAATGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 293 |
| LEAP-Seq percent confirming: | 99.094 |
| LEAP-Seq n confirming: | 875 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATCGGGCTCACGTCGTAT |
| Suggested primer 2: | CTGTTCGCACTTTCACCAGA |