| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.228586 |
| Chromosome: | chromosome 13 |
| Location: | 1418840 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g572050 | SMG1 | (1 of 1) K08873 - PI-3-kinase-related kinase SMG-1 (SMG1); Nonsense-mediated decay (NMD) pathway protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCTGCGCGCCGCCGCCACCAGCAACAAC |
| Internal bar code: | GCCGGACACCTAGCTTCCGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 380 |
| LEAP-Seq percent confirming: | 90.0 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGACTTAATCTCACCGCC |
| Suggested primer 2: | ACAACGACATGTGCAGCCT |