| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.228653 |
| Chromosome: | chromosome 12 |
| Location: | 4858093 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g525050 | SMC6A | (1 of 2) PTHR19306//PTHR19306:SF6 - STRUCTURAL MAINTENANCE OF CHROMOSOMES 5,6 SMC5, SMC6 // PROTEIN C23H4.6, ISOFORM A-RELATED; Structural Maintenance of Chromosomes protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGCGCTGCAGCGAGGCGGCCGAGGTGC |
| Internal bar code: | GGCGGGGCCCGACGAGCGCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 414 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 63 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGGGACAAGTACGACATCT |
| Suggested primer 2: | CGGCATTACACAAACACAGG |