| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.228881 |
| Chromosome: | chromosome 14 |
| Location: | 1419820 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g617650 | PDE1 | (1 of 20) 3.1.4.17 - 3',5'-cyclic-nucleotide phosphodiesterase / Cyclic AMP phosphodiesterase; 3'%252C5'-cyclic-nucleotide phosphodiesterase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGATGTTACGATCCGTTCTTGTTTGCCA |
| Internal bar code: | GTCCTGATTGGCCTGAAGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 695 |
| LEAP-Seq percent confirming: | 99.5745 |
| LEAP-Seq n confirming: | 2808 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGAGTCGTTGGTGGTTGT |
| Suggested primer 2: | AACCCATGTTTGCAGCCTAC |