Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.228882 |
Chromosome: | chromosome 7 |
Location: | 3658351 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g337300 | DSK2,DYRK2,DYRKP1,DYRKP,STD1 | Dual-Specificity Tyrosine-Regulated Protein Kinase involved in starch degradation; (1 of 2) PTHR24058//PTHR24058:SF23 - DUAL SPECIFICITY PROTEIN KINASE // SERINE/THREONINE KINASE-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGTGTGCAAGTTATCTACGCCGCATGGG |
Internal bar code: | ATTGCCCCCCCTCGCGAATCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 265 |
LEAP-Seq percent confirming: | 99.8141 |
LEAP-Seq n confirming: | 9666 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCGCGAGGTATTGTACTGG |
Suggested primer 2: | GGCAAGGCTTGACAACAACT |