| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.228944 |
| Chromosome: | chromosome 10 |
| Location: | 1268230 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g426950 | CYP739A3,CYP30 | (1 of 3) 1.14.13.126 - Vitamin D(3) 24-hydroxylase / CYP24A1; Cytochrome P450, CYP213 superfamily | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGACTGAATTGCCCAGCCCCAACAGCGA |
| Internal bar code: | GTACGCTTTCACAAATTTTCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 576 |
| LEAP-Seq percent confirming: | 97.2603 |
| LEAP-Seq n confirming: | 3692 |
| LEAP-Seq n nonconfirming: | 104 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGACCGTATCACCAAGCC |
| Suggested primer 2: | TATATGCAGCTGCTCGTTGG |