| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.228963 |
| Chromosome: | chromosome 12 |
| Location: | 3753524 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g515050 | HLM18,SET4 | putative N-methyltransferase; (1 of 1) PTHR13793:SF5 - HISTONE-LYSINE N-METHYLTRANSFERASE ATX4-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGGCGATGACTGTGAGCGGTGAAGAGT |
| Internal bar code: | GGTCTATTCGCGCTTCCCCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1036 |
| LEAP-Seq percent confirming: | 97.7669 |
| LEAP-Seq n confirming: | 1401 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCGCCACACATCATACAC |
| Suggested primer 2: | TCCTCAACACACAAACGACC |