| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.229006 |
| Chromosome: | chromosome 7 |
| Location: | 4246282 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g341900 | (1 of 781) IPR000104 - Antifreeze protein, type I | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCGTGCGTGTGTGTGTGTGTGCGTGCGT |
| Internal bar code: | TAGCGGTGTCGATGCATTGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 423 |
| LEAP-Seq percent confirming: | 99.6313 |
| LEAP-Seq n confirming: | 12161 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAGTGCAGGCGGTGAGT |
| Suggested primer 2: | CTTCTTTCTGGTCTGCCCTG |