| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.229008 |
| Chromosome: | chromosome 1 |
| Location: | 7256639 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g052350 | MRPL20,bL20m | (1 of 1) K02887 - large subunit ribosomal protein L20 (RP-L20, MRPL20, rplT); Mitochondrial ribosomal protein L20 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCCTGTATCGCATGCATCAATGTAAGGC |
| Internal bar code: | GGCTATGCTGCGTGGGCCACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1217 |
| LEAP-Seq percent confirming: | 99.5989 |
| LEAP-Seq n confirming: | 1738 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGCAGTGTTAGGGATGGG |
| Suggested primer 2: | CAGCACCGCTGACTTTCATA |