| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.229213 |
| Chromosome: | chromosome 12 |
| Location: | 4481795 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g521700 | SSS6,SSS1A | Soluble starch synthase IA; (1 of 5) K00703 - starch synthase (E2.4.1.21, glgA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCCTAGGCCTTTCTGCCTGCGCCCGCAC |
| Internal bar code: | TCCGGGTGCTCCCCGCAGTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 539 |
| LEAP-Seq percent confirming: | 99.5736 |
| LEAP-Seq n confirming: | 467 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTTGTAGCGCACGCTGTAG |
| Suggested primer 2: | CCTGCCTTAGTTGCTTCCAG |