| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.229298 |
| Chromosome: | chromosome 2 |
| Location: | 3530027 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095126 | DPE1,DPE2 | Disproportionating enzyme 2; (1 of 2) 2.4.1.25 - 4-alpha-glucanotransferase / Oligo-1,4-1,4-glucantransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTTCCAACCCGCCGCCGTCGTACGCCGT |
| Internal bar code: | TACTACCGGTCGCGGTGATTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 461 |
| LEAP-Seq percent confirming: | 99.5899 |
| LEAP-Seq n confirming: | 21126 |
| LEAP-Seq n nonconfirming: | 87 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCTCTCCTACCCGACACC |
| Suggested primer 2: | ACACACACACACGCACACAC |