| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.229347 |
| Chromosome: | chromosome 2 |
| Location: | 1859531 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g087400 | ZIL1,ZIP14 | protein of unknown function; (1 of 6) IPR002395 - HMW kininogen | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAAGCGAGCCTATCACGCCCCACAGCCT |
| Internal bar code: | TCTATTGGCCGATTTTGCGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1103 |
| LEAP-Seq percent confirming: | 99.3451 |
| LEAP-Seq n confirming: | 15927 |
| LEAP-Seq n nonconfirming: | 105 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGAGGATCACTTCAGCAA |
| Suggested primer 2: | ACATGCTTGAAACTCCCCAC |