| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.229424 |
| Chromosome: | chromosome 8 |
| Location: | 4620979 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g383450 | FIST N domain protein; (1 of 3) PF08495 - FIST N domain (FIST) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCATGCACGCAGTCAGCCTGCTCCAGT |
| Internal bar code: | TCGGCCTGCGTCGCATAATCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 509 |
| LEAP-Seq percent confirming: | 96.558 |
| LEAP-Seq n confirming: | 533 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAGTTTAACCGCCCCAAG |
| Suggested primer 2: | GCTTGAGACTGCAAGGAAGC |