| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.229477 |
| Chromosome: | chromosome 12 |
| Location: | 7568250 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g555450 | PMK,IPK,IMPK | (1 of 1) 2.7.1.140 - Inositol-tetrakisphosphate 5-kinase / 1D-myo-inositol-tetrakisphosphate 5-kinase; inositol-tetrakisphosphate 5-kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGTAAAGTGACAAGCATGAATTGCATTC |
| Internal bar code: | CACCCTTTGCTGAAGGTAGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 358 |
| LEAP-Seq percent confirming: | 99.4288 |
| LEAP-Seq n confirming: | 2437 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTCACAATCCAACGCAC |
| Suggested primer 2: | ACGTTACCATCCGCTTCATC |