| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.229576 |
| Chromosome: | chromosome 6 |
| Location: | 4906051 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g279250 | PYM1 | (1 of 1) K14294 - partner of Y14 and mago (WIBG, PYM); Partner of Y14/RBM8A-MAGOH | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGACGAGGATGCGGTGAATGAGAGGATG |
| Internal bar code: | CTATCGGTCGTCGTCACTGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 602 |
| LEAP-Seq percent confirming: | 99.0548 |
| LEAP-Seq n confirming: | 17711 |
| LEAP-Seq n nonconfirming: | 169 |
| LEAP-Seq n unique pos: | 145 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAAAGCAACACCTCACCC |
| Suggested primer 2: | TCGAGGCATATCCTGTTTCC |