Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.229610 |
Chromosome: | chromosome 9 |
Location: | 7080075 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g411600 | (1 of 3) IPR000104//IPR001005//IPR009057//IPR017877//IPR017930 - Antifreeze protein, type I // SANT/Myb domain // Homeodomain-like // Myb-like domain // Myb domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCGCAGCTGCCCCGCCTCCAGAGCGAAC |
Internal bar code: | TCGGTACCAATGCCCCGGTGACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 56.3758 |
LEAP-Seq n confirming: | 84 |
LEAP-Seq n nonconfirming: | 65 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTTTACGGGTGAGCGAGAG |
Suggested primer 2: | ATCCTCAGGCATCAACTGGA |