Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.229660 |
Chromosome: | chromosome 16 |
Location: | 6860535 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676197 | RPN1 | (1 of 1) K03028 - 26S proteasome regulatory subunit N1 (PSMD2, RPN1); 26S proteasome regulatory subunit | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGTATACTGCTCATATGCGGCCTTGGTC |
Internal bar code: | GTGCCCCCGCCTTACGGCCGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 791 |
LEAP-Seq percent confirming: | 94.3925 |
LEAP-Seq n confirming: | 202 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTCCGTGGAAGACGGTATG |
Suggested primer 2: | GGAGGAGGAGTGGTGTGTGT |