Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.229690 |
Chromosome: | chromosome 16 |
Location: | 396830 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g693500 | FAP40,ISG1,ISG-C1 | Hydroxyproline-rich Flagellar Associated Protein 40; (1 of 5) PTHR16631:SF9 - GLUCAN 1,3-BETA-GLUCOSIDASE | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCACTGAAGCCTAAGTACCCGCCCGCCAA |
Internal bar code: | TCAACCCGGTTTCCCCAACACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 396 |
LEAP-Seq percent confirming: | 46.6667 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAAGCTCTCCACAACATCA |
Suggested primer 2: | GGGTACCATCATGCTATGGG |