| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.229717 |
| Chromosome: | chromosome 2 |
| Location: | 318195 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g075400 | (1 of 6) PTHR15907//PTHR15907:SF21 - FAMILY NOT NAMED // DUF614 FAMILY PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAGTTAGCAAACAGCGAGGTGGGTGGTTA |
| Internal bar code: | CTGCTGCTTGGCCTCTTGTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 641 |
| LEAP-Seq percent confirming: | 96.3457 |
| LEAP-Seq n confirming: | 1371 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTAGCTGCTCACCCATCTC |
| Suggested primer 2: | TGCACCCAGGAGAACATACA |