Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.229826 |
Chromosome: | chromosome 9 |
Location: | 531878 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g404000 | CPLD59 | (1 of 1) PF00805 - Pentapeptide repeats (8 copies) (Pentapeptide); thylakoid lumenal 17.4 kDa protein | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTCGACAGGAGAAACACAACCACCGACC |
Internal bar code: | GCCGATTTTCCGTGGCCCAATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 593 |
LEAP-Seq percent confirming: | 99.3392 |
LEAP-Seq n confirming: | 1804 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTTCCTACCCACCGGTCTT |
Suggested primer 2: | GGCGTTCATGTCTACAGGGT |