| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.229882 |
| Chromosome: | chromosome 2 |
| Location: | 5160180 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g105400 | CDC14 | (1 of 1) K06639 - cell division cycle 14 (CDC14); Cell Division Cycle protein 14 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGAGGAGCGACTTCTTCACGCCTCCGTT |
| Internal bar code: | GTACGCGTCACCATGTATGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 475 |
| LEAP-Seq percent confirming: | 98.1417 |
| LEAP-Seq n confirming: | 845 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTACTAGGCAACCCTGAG |
| Suggested primer 2: | TGTTGGAGGGAGAGCAGTCT |