| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.229976 |
| Chromosome: | chromosome 6 |
| Location: | 2678544 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g270200 | PLC1,PLC | Phospholipase C; (1 of 1) 3.1.4.11 - Phosphoinositide phospholipase C / Triphosphoinositide phosphodiesterase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACACGTGTTCCGTCTCCATCCAGCAACT |
| Internal bar code: | TCGCGTATAATTGTGGTGCTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 452 |
| LEAP-Seq percent confirming: | 99.0724 |
| LEAP-Seq n confirming: | 2243 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCCAAATGAATGGTGTTG |
| Suggested primer 2: | AGGGCAACAATTACACAGGC |