Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.230002 |
Chromosome: | chromosome 12 |
Location: | 3057820 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g500450 | TPD1 | (1 of 2) PTHR12121:SF37 - 2',5'-PHOSPHODIESTERASE 12; 2'%252C5'-phosphodiesterase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGGCTGAGGGTGGCCAGCGAGGTGTGCC |
Internal bar code: | ACGGTGAGGGTGCTATGGGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 577 |
LEAP-Seq percent confirming: | 96.0854 |
LEAP-Seq n confirming: | 540 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACACATGACTGCAGCACCA |
Suggested primer 2: | GTGGTGCTGAGCTTGTCAAA |