| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.230051 |
| Chromosome: | chromosome 8 |
| Location: | 249685 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358554 | (1 of 14) 3.1.3.16//3.1.3.48 - Protein-serine/threonine phosphatase / Serine/threonine specific protein phosphatase // Protein-tyrosine-phosphatase / PTPase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTGGATGTGTCACGTGCGGCCCACCTGC |
| Internal bar code: | TTGTGATCGGGGAAAGATCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 480 |
| LEAP-Seq percent confirming: | 94.1667 |
| LEAP-Seq n confirming: | 113 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCCCTGTAAGACGAAAC |
| Suggested primer 2: | GGAGCCAGACCAGGACATAA |