Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.230053 |
Chromosome: | chromosome 12 |
Location: | 5660536 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g532350 | CAV8 | (1 of 2) PF00520//PF08016 - Ion transport protein (Ion_trans) // Polycystin cation channel (PKD_channel); Voltage-gated Ca2+ channel, alpha subunit | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCCAAGCTGTCGCCGCGTGTGCTGTCGC |
Internal bar code: | AGGCGATACCGGCCCTTGGGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 138 |
LEAP-Seq percent confirming: | 76.9036 |
LEAP-Seq n confirming: | 303 |
LEAP-Seq n nonconfirming: | 91 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCCAGACACGCTTGAGAAC |
Suggested primer 2: | CTGAAACGAACTGCTGGTCA |