Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.230159 |
Chromosome: | chromosome 6 |
Location: | 935561 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g255400 | (1 of 1) K12857 - Prp8 binding protein (SNRNP40, PRP8BP) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGGGGTGGCCAGGCGTGGATCCAGGGC |
Internal bar code: | CGTGGGTAAGCAGTCGCGGAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 452 |
LEAP-Seq percent confirming: | 81.6199 |
LEAP-Seq n confirming: | 262 |
LEAP-Seq n nonconfirming: | 59 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGACCTACTCCTTCGCCTG |
Suggested primer 2: | ACCTTTTCCTTCCCTTCCCT |