Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.230178 |
Chromosome: | chromosome 11 |
Location: | 2447086 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g475400 | (1 of 1) K11864 - BRCA1/BRCA2-containing complex subunit 3 (BRCC3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAAAAGAGCGGTACAGGATACACTGAA |
Internal bar code: | TGTCCCGTGTTGTAGGACGCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 704 |
LEAP-Seq percent confirming: | 99.4278 |
LEAP-Seq n confirming: | 14075 |
LEAP-Seq n nonconfirming: | 81 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACTTCCTCCCCTCATCAA |
Suggested primer 2: | TAGTGCATTGAAGCTGACGG |