| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.230318 |
| Chromosome: | chromosome 10 |
| Location: | 5994127 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g462750 | (1 of 1) K11374 - elongator complex protein 2 (ELP2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCATAATACAGCGTACGGTATCTAGTAC |
| Internal bar code: | CGGCGATCCGACGGTCCAGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 590 |
| LEAP-Seq percent confirming: | 97.211 |
| LEAP-Seq n confirming: | 2893 |
| LEAP-Seq n nonconfirming: | 83 |
| LEAP-Seq n unique pos: | 90 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGCCACGTACCTGTTTTT |
| Suggested primer 2: | GTGTCTCAGGACAGGTGGGT |