| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.230326 |
| Chromosome: | chromosome 10 |
| Location: | 1861064 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g431400 | TRZ1 | Nuclear RNase Z-like protein; (1 of 1) PTHR12553//PTHR12553:SF43 - RIBONUCLEASE Z // NUCLEAR RIBONUCLEASE Z | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCCCACGGGCCACGTGCCTACCCATCTT |
| Internal bar code: | GGTACCCCGAAACATAGAAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 669 |
| LEAP-Seq percent confirming: | 99.1031 |
| LEAP-Seq n confirming: | 663 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACTGCTTGCTCGGTCTGT |
| Suggested primer 2: | CTGCAACCCTGCACTCATAA |