| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.230328 |
| Chromosome: | chromosome 1 |
| Location: | 3874929 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g025150 | CPLD15 | conserved organelle protein with lipase active site; (1 of 1) PTHR11440:SF48 - HYDROLASE-LIKE PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTAAACATAGCCGGTCAGATTCCGGCACA |
| Internal bar code: | GGATACGCGACAGCTGTCTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 548 |
| LEAP-Seq percent confirming: | 99.6694 |
| LEAP-Seq n confirming: | 603 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCGCCTTCTCTCCTTTTT |
| Suggested primer 2: | CTCTCCTGGGGATTTCCTTC |