| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.230523 |
| Chromosome: | chromosome 1 |
| Location: | 2561783 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g014850 | (1 of 1) PTHR12281//PTHR12281:SF2 - RP42 RELATED // DCN1-LIKE PROTEIN 2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGGTTGCGCTTCCCCGCCCGCATCAGCA |
| Internal bar code: | GCTGGGGCTTTCAAGGGACCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1066 |
| LEAP-Seq percent confirming: | 99.0068 |
| LEAP-Seq n confirming: | 11364 |
| LEAP-Seq n nonconfirming: | 114 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGGCTTACACATCCCTGT |
| Suggested primer 2: | AATGTGGCCTTTGTACTGCC |