| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.230536 |
| Chromosome: | chromosome 6 |
| Location: | 2394375 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g267950 | HTR10 | Histone H3; (1 of 35) K11253 - histone H3 (H3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGAGCCAAGTCCCCCATCCATGACTTC |
| Internal bar code: | CCCCTGACCGCTACCTGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 408 |
| LEAP-Seq percent confirming: | 96.9325 |
| LEAP-Seq n confirming: | 158 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCAGGTAGTTGCTGCGTA |
| Suggested primer 2: | GATTGCCCAGGACTTCAAGA |