Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.230596 |
Chromosome: | chromosome 6 |
Location: | 2973055 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g273250 | GPA2,GPAT2 | Glycerol-3-phosphate acyltransferase; (1 of 1) K13506 - glycerol-3-phosphate O-acyltransferase 3/4 (GPAT3_4, AGPAT9, AGPAT6) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCATAGCTTGCCCAGCAGCGGGTGTTGAC |
Internal bar code: | AAAGGGGCAATCGGTTCGGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 617 |
LEAP-Seq percent confirming: | 99.6139 |
LEAP-Seq n confirming: | 774 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGATATCTGGGAAAGCAGG |
Suggested primer 2: | GAGGACTTAATGCAGCAGGC |